Skip to content

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

11 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

qgrs-cpp

C++ implementation of QGRS mapping algorithm - described here. This program differs from the actual algorithm used by QGRS Mapper recarding overlapping motifs and the maximum length of the motif. In particular, a maximum of 45nt is applied for all motifs with 3+ tetrads, while a maximum of 30nt is applied for motifs with 2 tetrads. The details of this, and dealing with overlapping motifs is described in detail in the following papers:

Getting the code

You can clone this repository with the following command (you need git installed on your machine!).

git clone https://github.com/freezer333/qgrs-cpp

Alternatively, you can download a zip file here

Building the code

Source code is found in the /src directory. You can build the program with any modern (C++11) compiler, on any platform/OS - there are no external dependencies.

If you are using maxOS or any UNIX/Linux-type system, you can build the program using make. If you have not configured your system to with make, you can compile the source code like so:

g++ -o qgrs src/default.cpp src/qgrs.cpp --std=c++11

The code has not been tested on Windows.

Using the tool

Once you've build the executable, you can access the help segment of the program using the -h flag.

./qgrs -h

The following command line options are supported:

-h                    help (this)
-csv                  output in csv mode
-json                 output in JSON mode
-i [input filename]   read input from a file as specified (defaults to stdin)
-o [output filename]  write output to file as specified (defaults to stdout)
-t [n]                filter output to QGRS with number tetrads equal to or greater than n (defaults to 2)
-s [n]                filter output to QGRS with g-score equal to or greater than n (defaults to 17)
-g [c]                replace all G characters within tetrads with given character.
-v                    include overlapping QGRS in output (very large outputs may be generated)
-notitle              omit column headings in output (does not apply for JSON)

Manually entering sequence data

The simplest way to run it from the command line is using all the defaults. To do this, simply execute bin/qgrs.

You'll need to enter the sequence data - you can enter multiple lines of characters. To allow the program to start (using the sequence), you must signal EOF, by typing Ctrl+D at the command line. You will see output generated.

bin/qgrs
GGAGGAGGAGG
^D
1           0  3  6  9  2  21  GGAGGAGGAGG

Understanding the output

By default, output is in columns - with the following values:

Column 1 - ID (order found in sequence).  
Column 2 - Position of the start of the first tetrad (relative to beginning of input sequence)
Column 3 - Position of the start of the second tetrad (relative to beginning of input sequence)
Column 4 - Position of the start of the third tetrad (relative to beginning of input sequence)
Column 5 - Position of the start of the fourth tetrad (relative to beginning of input sequence)
Column 6 - Number of tetrads
Column 7 - G-Score
Column 8 - Sequence

Using sequence data from a file

On a system that supports input redirection, you can use sequence data from a file as such:

bin/qgrs <samples/input.txt

The program will map QGRS from the input.txt file provided with the source code distribution.

Alternatively, you can use the -i flag and specify the input name - which will give you the same results.

bin/qgrs -i samples/input.txt

Saving output to files

You can redirect stdout when using the tool, or you can use the -o flag to have the mapping results stored in a resulting file.

bin/qgrs -i samples/input.txt >samples/output.txt
bin/qgrs -i samples/input.txt -o samples/output.txt

Saving output as a CSV /JSON files

The tool supports output in CSV format instead of the column-based output used as default.

bin/qgrs -csv -i samples/input.txt > samples/output.csv

Alternative, you can output as a JSON document

bin/qgrs -json -i samples/input.txt > samples/output.json

Filtering mapping results

QGRS can be filtered by minimum tetrad and minimum gscore using the -t and -s flags respectively.

The following will map QGRS from samples/nras.txt, filtering such that only QGRS with 3 tetrads and scores above 50 are presented in the output.

bin/qgrs -i samples/nras.txt -t 3 -s 50
1             14    18    23    29  3  62  GGGAGGGGCGGGTCTGGG
2             81    97   119   123  3  52  GGGACTCAGGCGCCTGGGGCGCCGACTGATTACGTAGCGGGCGGG
3           6690  6695  6700  6704  3  63  GGGGGGGGTTGGGGGGG

These flags can be specified in any order.

Overlapping QGRS

Most QGRS found have alternative forms found within them - or overlapping them. More information about this concept can be found here.

By default, the tools does not output overlapping sequences. You may use the -v option to enable their output.

bin/qgrs -i samples/nras.txt -t 3 -s 50 -v
1             14    18    23    29  3  62  GGGAGGGGCGGGTCTGGG
1.1           14    19    23    29  3  62  GGGAGGGGCGGGTCTGGG
2             81    97   119   123  3  52  GGGACTCAGGCGCCTGGGGCGCCGACTGATTACGTAGCGGGCGGG
2.1           81    96   119   123  3  51  GGGACTCAGGCGCCTGGGGCGCCGACTGATTACGTAGCGGGCGGG
3           6690  6695  6700  6704  3  63  GGGGGGGGTTGGGGGGG
3.1         6690  6694  6700  6703  3  62  GGGGGGGGTTGGGGGG
3.2         6690  6694  6700  6704  3  62  GGGGGGGGTTGGGGGGG
3.3         6690  6694  6701  6704  3  61  GGGGGGGGTTGGGGGGG
3.4         6690  6695  6700  6703  3  62  GGGGGGGGTTGGGGGG
3.5         6690  6695  6701  6704  3  62  GGGGGGGGTTGGGGGGG
3.6         6691  6695  6700  6703  3  62  GGGGGGGTTGGGGGG
3.7         6691  6695  6700  6704  3  63  GGGGGGGTTGGGGGGG
3.8         6691  6695  6701  6704  3  62  GGGGGGGTTGGGGGGG

Note the ID numbers - for example, QGRS #3 has 8 overlapping sequence variants - 3.1-3.8, each of which have lower g-scores. Filters (tetrads, g-scores) are applied to overlaps as well.

Substituting tetrad characters

To make it easier to read output, it's often nice to see which G characters are actually involved in the QGRS. You can use the -s flag to substitute tetrad G's with another character.

bin/qgrs -i samples/nras.txt -t 3 -s 50 -v -g @
1             14    18    23    29  3  62  @@@A@@@GC@@@TCT@@@
1.1           14    19    23    29  3  62  @@@AG@@@C@@@TCT@@@
2             81    97   119   123  3  52  @@@ACTCAGGCGCCTG@@@CGCCGACTGATTACGTAGC@@@C@@@
2.1           81    96   119   123  3  51  @@@ACTCAGGCGCCT@@@GCGCCGACTGATTACGTAGC@@@C@@@
3           6690  6695  6700  6704  3  63  @@@GG@@@TT@@@G@@@
3.1         6690  6694  6700  6703  3  62  @@@G@@@GTT@@@@@@
3.2         6690  6694  6700  6704  3  62  @@@G@@@GTT@@@G@@@
3.3         6690  6694  6701  6704  3  61  @@@G@@@GTTG@@@@@@
3.4         6690  6695  6700  6703  3  62  @@@GG@@@TT@@@@@@
3.5         6690  6695  6701  6704  3  62  @@@GG@@@TTG@@@@@@
3.6         6691  6695  6700  6703  3  62  @@@G@@@TT@@@@@@
3.7         6691  6695  6700  6704  3  63  @@@G@@@TT@@@G@@@
3.8         6691  6695  6701  6704  3  62  @@@G@@@TTG@@@@@@

Only a single character should be used as the substitute.

About

C++ implementation of QGRS mapping

Resources

Stars

7 stars

Watchers

1 watching

Forks

Releases

Packages

Contributors

Languages